20081823
Aarhus University Institute for Bioscience &
Interdiciplinary Center for Nanotechnology (iNANO) Supervised by Rikke Louise Meyer
Bacillus cereus
Abstract
Bacillus cereus
B. cereus
in vivo
Resume
Bacillus cereus
B. cereus
in vivo
Table of Contents
Acknowledgements ... ... 1
Abstract ... ...2
Resume ... ...2
1. Introduction ... ...5
Bacillus cereus ... ... 9
B. cereus
2 Materials and methods ... . 14
B. cereus B. cereus E. coli B. cereus
3 Results ... 22
B. cereus
4 Discussion ... .29
Bacillus cereus ... ... 29
sdh
5 Conclusion ... .39
6 References ... 40
Appendix ... . 51
.
Pseudomonas aeruginosa
B. subtilis
Staphylococci. B. subtilis
Bacilli as B. cereus B. subtilis
B. cereus
S. aureus
B. subtilis B. subtilis P. aeruginosa
Bacillus
Reversible adhesion
Irreversible
adhedsion Colony formation Mature biofilm and dispersal
B. subtilis
Bacillus subtilis
B. subtilis
B. subtilis
KinD Glycerol
Mn2+
SpoA-P
AbrB
epsA-epsO sipW
SinI
SlrR SinR Abh
tapA
Stress
B. subtilis
Bacillus subtilis
sipW
B. subtilis
B. subtilis
.
Bacillus cereus
Bacillus cereus
Bacillus anthracis Bacillus thuringiensis
B. cereus B. cereus
B. cereus
B. subtilis
B. cereus
B. cereus B. subtilis
B. cereus B. subtilis
B. thurgenesis, B. cereus
B. subtilis
B. subtilis
B. cereus
codY B.
subtilis
B. cereus codY
codY codY
codY
codY in B. cereus
B. cereus
B. cereus
in B. cereus
ppx, pap ppk are motA
increased
B. cereus
1.4 How to gain insight to the cellular mechanisms underlying
Streptococcus faecalis
.
ermB
B. subtilis
B. subtilis
B. subtilis
B. subtilis B. cereus
B. cereus
2 Materials and methods
B. cereus B. cereus Escherichia
coli E. coli B. subtilis
B. cereus
E. coli B. cereus
Bacilli
B. cereus
E. coli
Due to unsuccessful attempts to transform ATCC 10987 with the transposase plasmid pBTn, another approach was attempted and protocols altered. Figure 5 summarizes the pipeline for the following experiments.
E. coli . E. coli
E. coli
E. coli E. coli
in vivo
In vivo
E. coli
B. cereus
B. cereus
B. cereus
et al. et al.
B. cereus
E. coli B. cereus
B. cereus
a a
B. cereus
ermB
B. cereus
B. cereus
st
B. cereus
B. cereus
ermB
ermB S. aureus
ermB B. cereus
.
st
B. cereus
B. cereus B. subtilis
see B. subtilis
B. cereus
3 Results
B. cereus B. cereus
E. coli, S. aureus or B. cereus
in vivo
E. coli B. cereus B.
cereus
B. cereus .
B. cereus
ermB B. cereus.
B. cereus S.
aureus E. coli
B. cereus
in B. cereus ATCC
B. cereus
-0,5 0 0,5 1 1,5 2 2,5 3 3,5 4 4,5
OD585
Biofilm of WT and mutants
D5 C14 J22 L22 L23 E4 B4 L4 C8 WT
*
sdhA) B. cereus
sdh B.
subtilis sdhA B. cereus
sdhA ermB
B. cereus
sdh
sdh
B. subtilis
B. cereus
mM 3-NPA 0 0 10-8 10-7 10-6 10-5 10-4 EtOH - + + + + + +
sdh
*
. Data from acetate
.
Bacillus cereus
B. cereus
, B. cereus
,
, B. cereus
B. cereus,
B. cereus
in vitro in
vivo
B. cereus
, E. coli E. coli
E. coli
sdh .
sdh
.
B. cereus
erm
sdh sdh
sdhBAC::ermB .
sdh
Actinomyces
naeslundii B. cereus
B. subtilis B. cereus
.
ldhA in B. cereus genes in a ldhA
, B. subtilis
gltAB
sdh
sdh
S. aureus
S. aureus positive
Enterococcus faecalis sdh
S. epidermidis
sdh S. aureus
sdh
B. subtilis
B. cereus sdh
sdh
B. subtilis sdhB
sdhA sdhC B. cereus
sdhBAC
, ,
sdh sdh
.
S. epidermidis B. subtilis B. cereus
Pseudomonas aeruginosa Streptococcus mutans sdh
sdh
B. subtilis
E. coli B. subtilis sdh
B. cereus B. subtilis
E. coli, ackA
ackA pta
ackA ackA pta
B. cereus
E. coli
sdh B. cereus
sdh
Bacillus
B. subtilis
E. coli
ackA
ackA ackA pta on E.
coli
E. coli
B. subtilis
B. cereus
B. cereus
,
B. thuringenesis, ,
sinI
sdh B. cereus
sdh
sdh
,
a
B. cereus nhe
sdh
B. subtilis Streptococcus mutans rex B. cereus
S. aureus glnP
sdh
B. cereus S. mutans
in B. cereus sdh
B. subtilis
B. cereus B. cereus
B, thurgenesis
B. subtilis B. cereus
B. subtilis
sdh B. cereus
sdh B. cereus,
sdh
Bacilli Staphylococcus aureus
sdh
Candida albicans C. albicans
C. albicans.
B. cereus
sdh B. cereus
B. cereus
in vivo
B. cereus
sdh
is B. cereus
B. cereus
6 References
Prevotella bryantii Prevotella ruminicola
FEMS Microbiol Lett
Bacillus subtilis Mbio
Bacillus subtilis. FEMS Microbiol Lett
Bacillus cereus
Journal of Infection
Current Opinion in Biotechnology
Streptococcus mutans PLoS One
Bacillus subtilis Molecular Microbiology
Bacillus subtilis. Proc Natl Acad Sci U S A
Trends Microbiol
Staphylococcus carnosus Staphylococcus xylosus FEMS Microbiol Lett
Bacillus subtilis J Mol Microbiol Biotechnol
Bacillus subtilis Genes Dev
in Bacillus subtilis J Bacteriol
Molecular Microbiology
Bacillus cereus Applied and Environmental
Microbiology
Bacillus subtilis Molecular Microbiology
Escherichia coli Proceedings of the National Academy of Sciences of the United States of America
Bacillus subtilis J Bacteriol
Bacillus subtilis J Bacteriol
Helicobacter pylori Mol Microbiol
Measurement
Infect Immun
in Bacillus thuringiensis Plos One
Pseudomonas aeruginosa Journal of Bacteriology
Bacillus subtilis Journal of Bacteriology
Enterococcus faecalis
Journal of Bacteriology
Staphylococcus aureus J Bacteriol
Water Research
Journal of Applied Microbiology
Bacillus cereus PLoS One
Nature Biotechnology
International Journal of Food Microbiology
Bacillus cereus Bacillus weihenstephanensis
Applied and Environmental Microbiology
Staphylococcus aureus Infect Immun
European Journal of Biochemistry
Bacillus subtilis. Annual Review of Genetics
Bacillus subtilis Journal of Bacteriology
in Bacillus subtilis Journal of Bacteriology
Bacillus subtilis Molecular Microbiology
Bacillus subtilis. Mol Microbiol
Nat Protoc
Staphylococcus epidermidis Infect Immun
Journal of Chemical Technology and Biotechnology
Microbiology- Uk
Biochemical Engineering Journal
Bacillus
cereus Microbiology
Bacillus cereus Applied and Environmental Microbiology
Bacillus cereus Arch Microbiol
Bacillus cereus Arch Microbiol
Staphylococcus aureus J Bacteriol
Bacillus subtilis Proceedings of the National Academy of Sciences of the United States of America
Bacillus cereus Bacillus
anthracis Nature
Molecular Oral Microbiology
Bacillus subtilis J Bacteriol
Bacillus cereus
Appl Microbiol Biotechnol
Science
Bacillus subtilis Mol Microbiol
Bacillus subtilis Genes Dev
Bacillus subtilis FEMS Microbiol Lett
Pseudomonas aeruginosa Molecular Microbiology
Escherichia coli
Journal of Bacteriology
Bacillus cereus Journal of Bacteriology
Bacillus subtilis Microbiology-Sgm
Curr Opin Microbiol
Bacillus
subtilis Applied and Environmental
Microbiology
Pseudomonas aeruginosa Biophys J
Bacillus subtilis Curr Top Microbiol Immunol
Curr Top Microbiol Immunol
Bacillus thuringiensis J Microbiol Methods
Staphylococcus aureus Antimicrob Agents Chemother
in Bacillus cereus Environmental Microbiology
Bacillus subtilis Proceedings of the National Academy of Sciences of the United States of America
Cold Spring Harb Perspect Biol
Bacillus thuringiensis J Bacteriol
Adv Appl Microbiol
Anal Biochem
Bacillus
subtilis Fems Microbiology Letters
in Streptococcus gordonii
Journal of Bacteriology
J Bacteriol
Bacillus subtilis
Journal of Bacteriology
Bioorganic Chemistry
Pseudomonas aeruginosa Journal of Bacteriology
Bacillus subtilis J Bacteriol
Can J Vet Res
Bacillus cereus Appl Environ Microbiol
Escherichia coli
Journal of bacteriology
Escherichia coli? Molecular Membrane Biology
J Biomol Screen
Bacillus cereus Int J Food Microbiol
Bacilli Curr Opin
Biotechnol
Bacillus subtilis Cellular and Molecular Life Sciences
Bacillus subtilis Journal of Bacteriology
Bacillus cereus
Bacillus anthracis Nucleic Acids Research
Brazilian Journal of Microbiology
Bacillus subtilis J Microbiol
Methods
Bacillus subtilis Molecular Microbiology
Staphylococcus epidermidis Microbiology
Bacillus anthracis Journal of Bacteriology
Ann N Y Acad Sci
Eur J Biochem
Mbio
in Bacillus subtilis J Bacteriol
Staphylococcus aureus
Infection and Immunity
Bacillus cereus
Proceedings of the National Academy of Sciences of the United States of America
Bacillus subtilis Journal of Biochemistry
Mycoplasma pulmonis Infection and Immunity
Bacillus subtilis Nature Reviews Microbiology
Bacillus subtilis Journal of Bacteriology
Bacillus cereus FEMS Microbiol Rev
Bacillus subtilis Biotechnology Techniques
Curr Protoc Microbiol
Annual Review of Microbiology
Bacillus subtilis Proceedings of the National Academy of Sciences of the United States of America
J Agric Food Chem
Staphylococcus aureus Journal of Food Safety
Odontology
Streptococcus faecalis Cold Spring Harb Symp Quant Biol
Bacillus cereus Journal of Bacteriology
Bacillus cereus J Microbiol Methods
Bacillus
cereus J Appl
Microb Ecol
Cell Biophys
Bacillus subtilis J Bacteriol
Experientia
Bacillus
cereus Journal of Proteome Research
Bacillus cereus Appl Environ Microbiol
Genes & Development
Bacillus subtilis Nat Rev Microbiol
Journal of Bacteriology
Science
Bacillus cereus Appl Environ Microbiol
Pseudomonas aeruginosa
Journal of Bacteriology
Molecular Microbiology
Bacillus cereus J Bacteriol
Mycobacterium
smegmatis Microbiol Immunol
Actinomyces naeslundii Molecular Oral Microbiology
Bacteria PLoS Genet
Staphylococcus aureus in Vivo Infect Immun
International Journal of Food Microbiology
Appendix
B. cereus
Masters thesis by Matilde Greve Rasmussen
Fig S1 Phylogeneny showing relationship beteween B. subtilis and B. cereus
From Xu 2003
Masters thesis by Matilde Greve Rasmussen
Electro competent cells
Grow cells in 1000 ml of LB from o.n. culture Grow until OD600=0.6
Coll cells/medium on ice/water slurry
Spin down in cold 500 ml centrifugation tubes, that are designated for this work. 5000 rpm, 8 min (never send the tubes for dish washing. Clean in water and 70% ethanol. Sterilize)
Resuspend cell pellets in 50 ml of cold 10% glycerol, sterile. Then add 10% glycerol at approx.
300 ml
Spin down, 6000 rpm, 8 min , 4 deg C
Resuspend and spin down twice (i.e. use total of 1000 ml of 10% glycerol pr tube) Resuspend both pellets in 10 ml cold 10% glycerol and pool in a cold 50 ml sterile tube Spin down and resuspend cell pellet in 1.5 ml of cold 10% glycerol
Add 50 or 100 l pr cryotube and freeze in N2 immediately!
Fig S2 Protocol for preparing electro competent E. coli from Ove
Lillelund august 2013
Masters thesis by Matilde Greve Rasmussen
Fig S3 Protocol for precipitation of PCR products by Viduthalai Regina
Precipitation of PCR products using PolyEthylene Glycol (PEG) 8000 Materials and Reagents
0.5 ml microcentrifuge tubes
(One can also use 1.5ml microcentrifuge tubes as well, provided they are not the special tubes that have a ‘low bind’ inner wall in order to avoid losing the precipitated DNA during washing
~ 50 µl.)
PEG-NaCl stock (20% PEG-8000, 2.5M NaCl) For 50 ml:
PEG-8000 : 10.0 g (PEG Mol. weight 6000-8000) NaCl : 7.3 g
Dissolve the above in 45 ml dH2O (PEG takes ~20 minutes to dissolve). Put into a rocking
incubator, set at 37o 2O. Autoclave at
121oC for 20 minutes.
70% Ethanol
Procedure
Add equal volume of PEG-NaCl and the PCR reaction mixture in to a 0.5 ml microcentrifuge tube and mix well by vortexing at high speed or by pipetting up and down several times.
volume, 45µl, and add 45 µl of PEG-NaCl)
Incubate the above mixture at 37oC for 15-20 minutes.
Centrifuge the PCR + PEG-NaCl mixture at high speed (~15000 x g) for 20 minutes at room temperature.
Use a pipette to pull of the supernatant and discard it (Be careful that the pellet is not disturbed during pipetting – try to pull of the supernatant as slow as possible. It is safe to leave a little amount of the supernatant in the tube that can be washed later).
Add 150 µl of 70% ethanol. Vortex the tube for 30 seconds.
Centrifuge at high speed for 20 minutes at room temperature.
by inverting the tube.
Repeat step 5, 6, & 7.
Press the mouth of the tube against a lab tissue paper to get rid of the ethanol on the tube walls.
in many reactions).
Dissolve the dried DNA pellet in 25-30 µl (if 50 µl PCR reaction was used) sterile milliQ / DNase free completely.
Store at -20o o
used to dissolve the DNA).
Masters thesis by Matilde Greve Rasmussen
B. cereus
gel with PCR products of erm with primers Ery rev/Ery for (from Hussein 2001)
Fig S5 PCR products after 2
ndarbitrary PCR with primers as indicated on the
Masters thesis by Matilde Greve Rasmussen
B. cereus
Primers for additional controls of erm insert
Primer name Sequence Source
Erm3-external TCAAGCAATGAAACACGCCAA Arbitrary PCR This study Erm3-internal TAAAGAGGTCCCTAGCGCCT Arbitrary PCR – nested
primer Sequencing
This study
Erm3.3
TACTTATGAGCAAGTATTGTCTA Arbitrary PCR from Li et al. 2009 Erm3.2
ATTCTATGAGTCGCTTTTGTA
Arbitrary PCR from Li et al. 2009 Erm3.1
TAGGTATACTACTGACAGCTTC
Arbitrary PCR – nested primer
Sequencing
from Li et al. 2009
erm in B. cereus
mutants
Masters thesis by Matilde Greve Rasmussen
BR1 -14,4 -10,9
-13 -12,1
-14,3 -10,8
BR2 -11,8 -10,8
-12,1 -11,4
-14,7 -11
-12,8 -12,4 -14,1 -13,5 -14,9 -12,8 -12,7 -10,8
-14,5 -13
-12,7 -12,1 -14,4 -14,7 -13,1 -12,4 -12,9
BR3 -11,9 -10,5
-12,8 -10,9 -13,6 -12,4 -13,4 -11,4
-15 -11,8
-14,7 -13,1 -12,7 -12,6
-13 -13,2
-13,5 -13,2
Average -13,46 -12,08
0,98 1,10
p associated with T.test: 0,000045
(2-tailed, type 3)
B.
cereus
B. cereus
Masters thesis by Matilde Greve Rasmussen
Fig S10 Primer design of primer erm3 internal/external and erm5 internal/
Masters thesis by Matilde Greve Rasmussen
erm-internal
Masters thesis by Matilde Greve Rasmussen
